Upload
baldwin-beasley
View
219
Download
0
Embed Size (px)
DESCRIPTION
3 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames) Project Grading Breakdown 50% Final Project Demo 30% Final Project Report –20% of your project report grade will come from your 5-6 project updates. Friday’s midnight 20% Final Project Presentation
Citation preview
1 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)
CPRE 583Reconfigurable ComputingLecture 24: Fri 11/18/2011
(Evolvable Hardware)
Instructor: Dr. Phillip Jones([email protected])
Reconfigurable Computing LaboratoryIowa State University
Ames, Iowa, USA
http://class.ee.iastate.edu/cpre583/
2 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)
•HW3: will be assigned as extra credit
•Exam 2– Reminder push back to Friday after Thanksgiving week– Note: I will have a substitute administrating the exam since I will be
attending a conference.
•Weekly Project Updates due: Friday’s (midnight)
Announcements/Reminders
3 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)
Project Grading Breakdown
• 50% Final Project Demo• 30% Final Project Report
– 20% of your project report grade will come from your 5-6 project updates. Friday’s midnight
• 20% Final Project Presentation
4 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)
• FPL• FPT• FCCM• FPGA• DAC• ICCAD• Reconfig• RTSS• RTAS• ISCA
Projects Ideas: Relevant conferences• Micro• Super Computing• HPCA• IPDPS
5 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)
• Teams Formed and Topic: Mon 10/10– Project idea in Power Point 3-5 slides
• Motivation (why is this interesting, useful)• What will be the end result• High-level picture of final product
– Project team list: Name, Responsibility• High-level Plan/Proposal: Fri 10/14
– Power Point 5-10 slides (presentation to class Wed 10/19)• System block diagrams• High-level algorithms (if any)• Concerns
– Implementation– Conceptual
• Related research papers (if any)
Projects: Target Timeline
6 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)
• Work on projects: 10/19 - 12/9– Weekly update reports
• More information on updates will be given• Presentations: Finals week
– Present / Demo what is done at this point– 15-20 minutes (depends on number of projects)
• Final write up and Software/Hardware turned in: Day of final (TBD)
Projects: Target Timeline
7 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)
Initial Project Proposal Slides (5-10 slides)• Project team list: Name, Responsibility (who is project leader)
– Team size: 3-4 (5 case-by-case)• Project idea
• Motivation (why is this interesting, useful)• What will be the end result• High-level picture of final product
• High-level Plan– Break project into mile stones
• Provide initial schedule: I would initially schedule aggressively to have project complete by Thanksgiving. Issues will pop up to cause the schedule to slip.
– System block diagrams– High-level algorithms (if any)– Concerns
• Implementation• Conceptual
• Research papers related to you project idea
8 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)
Weekly Project Updates
• The current state of your project write up– Even in the early stages of the project you
should be able to write a rough draft of the Introduction and Motivation section
• The current state of your Final Presentation– Your Initial Project proposal presentation
(Due Wed 10/19). Should make for a starting point for you Final presentation
• What things are work & not working• What roadblocks are you running into
9 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)
Common Questions
10 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)
• Text: Chapter 33• Readings:
– #8: A new species of hardware (2000) – #9: Real-world applications of analog and digital
evolvable hardware (1999) – #10: Generalized Disjunction Decomposition for
Evolvable Hardware (2006)
Resources on Evolvable Hardware
11 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)
• Understand Evolvable Hardware basics?• Benefits and Drawbacks• Key types/categories
What you should learn
12 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)
• One of the first papers to compare reconfigurable HW with biological organisms (1993) – “Evolvable Hardware with Genetic Learning: A first step
towards building a Darwin Machine”, Higuchi– Biological organism => DNA
• GATACAAAGATACACCAGATA– Reconfigurable Hardware => Configuration bitstream
• 000100111011011011011010101
Evolvable Hardware
13 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)
• One of the first papers to compare reconfigurable HW with biological organisms (1993) – “Evolvable Hardware with Genetic Learning: A first step
towards building a Darwin Machine”, Higuchi– Biological organism => DNA
• GATACAAAGATACACCAGATA– Reconfigurable Hardware => Configuration bitstream
• 000100111011011011011010101
Evolvable Hardware
GATACA
GenotypePhenotype
14 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)
• One of the first papers to compare reconfigurable HW with biological organisms (1993) – “Evolvable Hardware with Genetic Learning: A first step
towards building a Darwin Machine”, Higuchi– Biological organism => DNA
• GATACAAAGATACACCAGATA– Reconfigurable Hardware => Configuration bitstream
• 000100111011011011011010101
Evolvable Hardware
GATACA
GATAGA
GenotypePhenotype
15 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)
• One of the first papers to compare reconfigurable HW with biological organisms (1993) – “Evolvable Hardware with Genetic Learning: A first step
towards building a Darwin Machine”, Higuchi– Biological organism => DNA
• GATACAAAGATACACCAGATA– Reconfigurable Hardware => Configuration bitstream
• 000100111011011011011010101
Evolvable Hardware
GATACA
GATAGA
GenotypePhenotype
16 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)
• One of the first papers to compare reconfigurable HW with biological organisms (1993) – “Evolvable Hardware with Genetic Learning: A first step
towards building a Darwin Machine”, Higuchi– Biological organism => DNA
• GATACAAAGATACACCAGATA– Reconfigurable Hardware => Configuration bitstream
• 000100111011011011011010101
Evolvable Hardware
0001 1100
GenotypePhenotype
17 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)
• One of the first papers to compare reconfigurable HW with biological organisms (1993) – “Evolvable Hardware with Genetic Learning: A first step
towards building a Darwin Machine”, Higuchi– Biological organism => DNA
• GATACAAAGATACACCAGATA– Reconfigurable Hardware => Configuration bitstream
• 000100111011011011011010101
Evolvable Hardware
0001 1100
0001 0000
GenotypePhenotype
18 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)
• One of the first papers to compare reconfigurable HW with biological organisms (1993) – “Evolvable Hardware with Genetic Learning: A first step
towards building a Darwin Machine”, Higuchi– Biological organism => DNA
• GATACAAAGATACACCAGATA– Reconfigurable Hardware => Configuration bitstream
• 000100111011011011011010101
Evolvable Hardware
0001 1100
0001 0000
DFF
DFF
GenotypePhenotype
19 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)
• Phylogeny Ontogeny Epigenesis (POE) – Phylogeny: Evolution through recombination and mutations
• Biological reproduction : Genetic Algorithms– Ontogeny: Self replication
• Multicellular organism's cell division : Cellular Automata– Epigenesis: adaptation trigger by external environment
• Immune system development : Artificial Neural Networks
Classifying Adaption/Evolution
20 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)
• Phylogeny Ontogeny Epigenesis (POE) – Phylogeny: Evolution through recombination and mutations
• Biological reproduction : Genetic Algorithms– Ontogeny: Self replication
• Multicellular organism's cell division : Cellular Automata– Epigenesis: adaptation trigger by external environment
• Immune system development : Artificial Neural Networks
Classifying Adaption/Evolution
Ontogeny
Epigenesis
Phylogeny
21 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)
• 30/40 year old concept. But applying to reconfigurable hardware is newish (1990’s)
• Evolutionary Algorithms (EAs)– Genetic Algorithms– Genetic Programming– Evolution Strategies– Evolutionary programming
Artificial Evolution
22 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)
• 30/40 year old concept. But applying to reconfigurable hardware is newish (1990’s)
• Evolutionary Algorithms (EAs)– Genetic Algorithms– Genetic Programming– Evolution Strategies– Evolutionary programming
Artificial Evolution
23 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)
• Genome: a finite string of symbols encoding an individual
• Phenotype: The decoding of the genome to realize the individual
• Constant Size population
• Generic steps– Initial population– Decode– Evaluate (must define a fitness function)– Selection– Mutation– Cross over
Genetic Algorithms
24 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)
Genetic AlgorithmsInitialize Population
0000 10001010 11111100 00001111 00000000 00001111 1111
Decode Evaluate
Selection
Mutation
Next Generation
CrossOver
25 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)
Genetic AlgorithmsInitialize Population
0000 10001010 11111100 00001111 00000000 00001111 1111
Decode Evaluate
1010 00111010 01001100 00001111 00000000 00001111 0100
Selection
Mutation
Next Generation
CrossOver
0000 = Black1111 = White
Left 4 bits: color
0000 = 01111 = 15
Right 4 bits: # sides
26 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)
Genetic AlgorithmsInitialize Population
0000 10001010 11111100 00001111 00000000 00001111 1111
Decode Evaluate
1010 00111010 01001100 00001111 00000000 00001111 0100
Selection
Mutation
Next Generation
CrossOver
(0110 1000)
0000 = Black1111 = White
Left 4 bits: color
0000 = 01111 = 15Right 4 bits: # sides
27 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)
Genetic AlgorithmsInitialize Population
0000 10001010 11111100 00001111 00000000 00001111 1111
Decode Evaluate
1010 00111010 01001100 00001111 00000000 00001111 0100
1010 0011 (.40)1010 0100 (.70)1100 0000 (.20)1111 0000 (.10)0000 0000 (.10)1111 0100 (.60) (0110 1000)
Selection
Mutation
Next Generation
CrossOver
28 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)
Genetic AlgorithmsInitialize Population
0000 10001010 11111100 00001111 00000000 00001111 1111
Decode Evaluate
1010 00111010 01001100 00001111 00000000 00001111 0100
1010 0011 (.40)1010 0100 (.70)1100 0000 (.20)1111 0000 (.10)0000 0000 (.10)1111 0100 (.60) (0110 1000)
Selection
1010 0011 (.40)1010 0100 (.70)1111 0100 (.60)
Mutation
Next Generation
CrossOver
29 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)
Genetic AlgorithmsInitialize Population
Decode Evaluate
1010 00111010 01001100 00001111 00000000 00001111 0100
1010 0011 (.40)1010 0100 (.70)1100 0000 (.20)1111 0000 (.10)0000 0000 (.10)1111 0100 (.60) (0110 1000)
Selection
1010 0011 (.40)1010 0100 (.70)1111 0100 (.60)
Mutation
1110 0011 1010 1100 1110 0100
1010 0111 0010 0110 1111 0100
Next Generation
CrossOver
0000 10001010 11111100 00001111 00000000 00001111 1111
30 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)
Genetic AlgorithmsInitialize Population
Decode Evaluate
1010 00111010 01001100 00001111 00000000 00001111 0100
1010 0011 (.40)1010 0100 (.70)1100 0000 (.20)1111 0000 (.10)0000 0000 (.10)1111 0100 (.60) (0110 1000)
Selection
1010 0011 (.40)1010 0100 (.70)1111 0100 (.60)
Mutation
1110 0011 1010 1100 1110 0100
1010 0111 0010 0110 1111 0100
1110 1100 1010 0011 1110 0100
1010 0110 0010 0111 1111 0100
Next Generation
CrossOver
0000 10001010 11111100 00001111 00000000 00001111 1111
31 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)
Genetic AlgorithmsInitialize Population
Decode Evaluate
1010 00111010 01001100 00001111 00000000 00001111 0100 (0110 1000)
Selection
1010 0011 (.40)1010 0100 (.70)1111 0100 (.60)
Mutation
1110 0011 1010 1100 1110 0100
1010 0111 0010 0110 1111 0100
1110 1100 1010 0011 1110 0100
1010 0110 0010 0111 1111 0100
Next Generation
CrossOver
1110 1100 1010 0011 1110 01001010 0110 0010 0111 1111 0100
1010 0011 (.40)1010 0100 (.70)1100 0000 (.20)1111 0000 (.10)0000 0000 (.10)1111 0100 (.60)
32 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)
Genetic AlgorithmsInitialize Population
Decode Evaluate
1110 11001010 00111110 01001010 01100010 01111111 0100
1010 0011 (.40)1010 0100 (.70)1100 0000 (.20)1111 0000 (.10)0000 0000 (.10)1111 0100 (.60) (0110 1000)
Selection
1010 0011 (.40)1010 0100 (.70)1111 0100 (.60)
Mutation
1110 0011 1010 1100 1110 0100
1010 0111 0010 0110 1111 0100
1110 1100 1010 0011 1110 0100
1010 0110 0010 0111 1111 0100
Next Generation
CrossOver
1110 1100 1010 0011 1110 01001010 0110 0010 0111 1111 0100
33 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)
Genetic AlgorithmsInitialize Population
Decode Evaluate
1110 11001010 00111110 01001010 01100010 01111111 0100 (0110 1000)
Selection
1010 0011 (.40)1010 0100 (.70)1111 0100 (.60)
Mutation
1110 0011 1010 1100 1110 0100
1010 0111 0010 0110 1111 0100
1110 1100 1010 0011 1110 0100
1010 0110 0010 0111 1111 0100
Next Generation
CrossOver
1110 1100 1010 0011 1110 01001010 0110 0010 0111 1111 0100
1110 1100 (.70) 1010 0011 (.40) 1110 0100 (.65) 1010 0110 (.85) 0010 0111(.80) 1111 0100 (.60)
34 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)
Genetic AlgorithmsInitialize Population
Decode Evaluate
1110 11001010 00111110 01001010 01100010 01111111 0100 (0110 1000)
Selection
1110 1100 (.70)1010 0110 (.85)0010 0111 (.80)
Mutation
1110 0011 1010 1100 1110 0100
1010 0111 0010 0110 1111 0100
1110 1100 1010 0011 1110 0100
1010 0110 0010 0111 1111 0100
Next Generation
CrossOver
1110 1100 1010 0011 1110 01001010 0110 0010 0111 1111 0100
1110 1100 (.70) 1010 0011 (.40) 1110 0100 (.65) 1010 0110 (.85) 0010 0111(.80) 1111 0100 (.60)
35 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)
Evolvable Hardware Platform
36 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)
• GA are a type of guided search
• Why use a guide search? Why not just do an exhaustive search?
Genetic Algorithms
37 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)
• GA are a type of guided search
• Why use a guide search? Why not just do an exhaustive search?
• Assume – 1 billion individuals can be evaluated a second– The genome of a individual is 32-bits in size– How long to do an exhaustive search?
Genetic Algorithms
38 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)
• GA are a type of guided search
• Why use a guide search? Why not just do an exhaustive search?
• Assume – 1 billion individuals can be evaluated a second– Now genome of a individual is a FPGA
• 1,000,000 bits in size– How long to do an exhaustive search?
Genetic Algorithms
39 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)
• Extrinsic Evolution (furthest from biology)– Evolution done in SW, then result realized in HW
• Intrinsic Evolution– HW is used to deploy individuals– Results are sent back to SW for fitness calculation
• Complete Evolution– Evolution is completely done on target HW device
• Open-ended Evolution (closest to biology)– Evaluation criteria changes dynamically
Evolvable Hardware Taxonomy
OntogenyEpigenesis
Phylogeny
40 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)
Evolvable Hardware Applications• Prosthetic Hand controller chip
– Kajitani “An Evolvable Hardware Chip for Prostatic Hand Controller”, 1999
41 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)
Evolvable Hardware Applications• Tone Discrimination and Frequency generation
– Adrian Thompson “Silicon Evolution”, 1996
Xilinx XC6200
42 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)
Evolvable Hardware Applications• Tone Discrimination and Frequency generation
Node Functions Node Genotype
43 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)
Evolvable Hardware Applications• Tone Discrimination and Frequency generation
Evolved 4KHz oscillator
44 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)
Benefits of Evolvable Hardware?
45 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)
Evolvable Hardware Issues?
46 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)
Evolvable Hardware Issues?
47 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)
Evolvable Hardware Platforms• Commercial Platforms
– Xilinx XC6200• Completely multiplex base, thus could program
random bitstreams dynamically without damaging chip
– Xilinx Virtex FPGA• Custom Platforms
– POEtic cell– Evolvable LSI chip (Higuchi)
48 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)
Next Lecture
• Exam 2 Overview
49 - CPRE 583 (Reconfigurable Computing): Evolvable Hardware Iowa State University (Ames)
Notes• Notes